Reverse complement DNA sequences

Friday, November 15th, 2024

This program reverse complements DNA sequences. Input must be single or mutiple sequences in FASTA format.

Sequence to reverse complement:

Upload a sequence file in FASTA format

[ Show different Image ] Solve the problem:

Result:

Single-letter codes
for amino acids

Adopted by IUPAC and IUBMB

	Amino Acid	SLC
1	Isoleucine	I
2	Leucine	L
3	Valine	V
4	Phenylalanine	F
5	Methionine	M
6	Cysteine	C
7	Alanine	A
8	Glycine	G
9	Proline	P
10	Threonine	T
11	Serine	S
12	Tyrosine	Y
13	Tryptophan	W
14	Glutamine	Q
15	Asparagine	N
16	Histidine	H
17	Glutamic acid	E
18	Aspartic acid	D
19	Lysine	K
20	Arginine	R

IUPAC IUBMB

The FASTA format must start with '>'. Check that this is the first character and that there are no spaces before '>'.

Example of FASTA format:


      > my interesting sequence number 1
      ATGCATGCAGACTGTACGTAGCATCGA
      GATGAGGGGAGAGAGGCGCGCTGTGATGTAGT
      > my exiting sequence number 2
      ATGCATGCAGACTGTACGTAGCATCGA
      GATGAGGGGAGAGAGGCGCGCTGTG

Reverse complement DNA sequences

Single-letter codes for amino acids

Adopted by IUPAC and IUBMB

Single-letter codes
for amino acids